The manuscripts should be submitted online using the ZVJ online submission system by registration using the link (http://zvjz.journals.ekb.eg/).
Peer Reviewing Process
Zagazig Veterinary Journal (ZVJ) aims to provide all authors with an efficient and consistent editorial process. Submitted manuscripts will be assigned to a member of the editorial team who is an expert in the field. The editor will assess the manuscript to determine whether it is within the scope of the journal, the quality of the data presented, and the novelty of the work before sending it for peer review.
The journal follows a double peer reviewing process. The manuscript will be sent to at least two reviewers (based on the decision of the Chief Editor), who will be asked to assess whether the manuscript is technically and scientifically sound, coherent and with acceptable writing quality. The final editorial decision will be based on the recommendations of the peer reviewers, provided these recommendations are in accord without any strong dissenting opinions. The paper is then assessed by a member of the journal's Editorial Board to ensure that all technical, language and scientific aspects are fulfilled. Once all reviews have been received and considered by the editors, a final decision will be sent to the corresponding author. Possible final decisions include:
ACCEPT AS SUBMITTED (with routine editing)
ACCEPT WITH MINOR REVISIONS
ACCEPT WITH MAJOR REVISION
REJECT
Copyright
Any manuscript submitted to the journal must not be under consideration by any other journal or already published in any journal or another citable form. Submission of a manuscript to ZVJ implies that all authors have read and agreed to its content and responsible for the reported findings. Authors must complete and sign the Copyright Release Form during manuscript submission. Please download the copy write release form from the link (http://zvjz.journals.ekb.eg/journal/authors.note). Complete the form, all the authors should sign the form, then scan and upload the scanned photo during the submission.
Publication Ethics
Originality
The authors must certify that the material submitted for publication has not been published except in abstract form, and is not being considered for publication elsewhere.
Ethics of experimentation
The Journal will only accept manuscripts in which there is evidence of the ethical use of animals or harmful substances. The care and use of experimental animals must comply with all relevant local animal welfare laws, guidelines and policies, and a statement of such compliance should be provided upon submission. Editors reserve the right to reject papers if there is doubt as to whether appropriate procedures have been used.
For research conducted in Zagazig University, the Materials and Methods section should include a statement that the study obtained ethics approval from Zagazig University Institutional Animal Care and Use Committee “ZU-IACUC” (or a statement that it was not required), including the name of the ethics committee(s) or institutional review board(s), the number/ID of the approval(s), and a statement that participants gave informed consent before taking part. The application forms of ZU-IACUC can be downloaded from this LINK. For research conducted in other institutions, ethical approval should be included with regard to the relevant committee.
Research misconducts
Plagiarism
The manuscript is checked on submission by iThenticate, in case of similarity index more than 20%, the Editor contact the corresponding author with the plagiarism report to adjust and reform the plagiarized texts. The re-submitted edited manuscript is then re-checked and if the similarity index is not satisfactory, the Editor will contact other authors until obtaining the required similarity index.
Fabrication and/or Falsification
In case of a report of suspected fabrication and/or falsification from the peer-reviewer, the Editor will contact for a second opinion from another peer-reviewer. If the same outcome has been issued, the Editor will contact the author for full explanation without direct accusation. If there is no satisfactory response, the Editor will inform all authors to clarify the situation. In case of no response, the manuscript will be rejected.
Complaints process
This procedure applies to complaints about the policies, procedures, or actions of ZVJ editorial staff. We welcome complaints as they provide an opportunity for improvement, and we aim to respond quickly, courteously, and constructively.
The complainant is not simply disagreeing with a decision we have made or something we have published but must be about something that is within the responsibility of the editorial department - content or process.
Complaints can be made by sending an email to zvj@vet.zu.edu.eg, All complaints will be acknowledged within three working days and a full detailed response will be made within two weeks.
Conflict of interest
Journal submissions are assigned to editors in an effort to minimize potential conflicts of interest. The following relationships between editors and authors are considered conflicts and are avoided: Current colleagues, recent colleagues, recent co-authors, and doctoral students for which editor served as committee chair. After papers are assigned, individual editors are required to inform the managing editor of any conflicts not included in the list above. In the event that none of the editors satisfy all of the conflict screens, co-editors who are least conflicted will be assigned to the manuscript. In addition, co-editors who are least conflicted are assigned for all paper submissions by sitting editors. Journal submissions are also assigned to referees to minimize conflicts of interest. After papers are assigned, referees are asked to inform the editor of any conflicts that may exist.
In case of submission of manuscripts by a member of the editorial board, the Editor In Chief is the only one responsible for the distribution of the manuscript to relevant peer-reviewers (Double-blind peer reviewing process).
Authorship
All the authors in a manuscript are responsible for the technical information communicated. For this reason, it is necessary that all authors must read and approve the final version of the manuscript before signing the consent and declaration form. All named authors must have made an active contribution to the conception and design and/or analysis and interpretation of the data and/or the drafting of the paper and All must have critically reviewed its content and have approved the final version submitted for publication. Participation solely in the acquisition of funding or the collection of data does not justify authorship.
Zagazig Veterinary Journal adheres to the definition of authorship set up by The International Committee of Medical Journal Editors (ICMJE). According to the ICMJE authorship criteria should be based on 1) substantial contributions to conception and design of, or acquisition of data or analysis and interpretation of data, 2) drafting the article or revising it critically for important intellectual content and 3) final approval of the version to be published. Authors should meet conditions 1, 2 and 3.
It is a requirement that all authors have been accredited as appropriate upon submission of the manuscript. Contributors who do not qualify as authors should be mentioned under Acknowledgements.
Change in authorship: We do not allow any change in authorship after provisional acceptance. We cannot allow any addition, deletion or change in the sequence of an author name.
Similarity index
We check the similarity index with the use of plagiarism detection software (iThenticate). To reduce the similarity, please give proper citations and use the words and sentences carefully. Similarity index should not exceed 20%, otherwise, the manuscript will be rejected before the reviewing process.
Organization of the Manuscript
Articles should be typed double spaced using twelve point Times New Roman.
Original Articles: These should not be less than 3500 words and should not exceed 6000 words (including references, tables, figure legends) and should be organized in the following sections: Title page, Abstract, Introduction, Materials and methods, Results, Discussion (or Results and Discussion), Conflict of Interest, Acknowledgments, References, Figures Legends, Figure (in a separate file) and Tables.
Reviews: These are summaries of developments in areas related to veterinary science which are of broad interest to the target audience of the journal. These are usually invited, but authors identifying a need and wishing to submit a review article are welcome to contact the Editorial Office. Authors are advised to contact the Editorial Office before the commencement of writing to ensure that a similar topic has not already been commissioned to another Author. The review article should not exceed 9000 words including references.
Short communication: Should not exceed 2000 words including references, with no more than two tables, two figures and 10 references
Case studies: Should not exceed 1,000 words with no more than 10 references and one table or figure.
Layout of Manuscripts
Title Page:
The Title Page is submitted separately from the manuscript during the online submission.
The title page should include the title of the manuscript as well as the full names and institutional affiliations for all authors. The corresponding author should also be indicated (provide address and email).
Title: The title should contain no more than 150 characters (including spaces) and should be specific to the study. It should be comprehensible to a broad spectrum of readers.
Running Title: Should not exceed 40 characters.
Authors and Affiliations: This section should include the first names, middle initials (if used), surnames, and affiliations (university or organization), department, city, state/province (if applicable), and country for all authors. The institution/laboratory where the work was conducted should be indicated. One of the authors should be designated as the corresponding author. Full contact details including postal address, telephone and fax numbers, and email address for the corresponding author must be provided.
The Manuscript: The names and affiliations of the authors should NOT be included in the manuscript file.
Abstract The abstract must be not less than 150 words and shouldnot exceed 300 words. Citations, tables and abbreviations should be avoided. The techniques used must be mentioned without going into methodological detail and the most important findings should be summarized.
Key words
The authors must provide 3-5 keywords separated by semicolons or commas.
Introduction The introduction should be concise and be written in a way understandable to researchers without specialist/expert knowledge in the area. Relevant controversies or disagreements in the field should be mentioned. The introduction should conclude with a comment about the overall aims of the study.
Materials and Methods
This section should include the study design, setting, materials involved, as well as a description of all interventions and comparisons. The authors should also provide a description of the type of statistical analysis used, including a power calculation when appropriate. Well-established methodologies should simply be mentioned and referenced appropriately. For new methods, the protocols for the method should be included. Generic drug names should generally be used and in cases where proprietary brands have been used, the brand names must be included in parenthesis. Where available, the accession numbers of any nucleic acid sequences and protein sequences cited in the manuscript and the corresponding database name should be provided. When referencing a manufacturer with reagents or equipment used, the city and country where the manufacturer is located should also be provided.
Results The results section should be written in past tense and should provide details of findings that are required to support the manuscript's conclusions. To enhance clarity, the section may be divided into subsections, each with a concise subheading. Where appropriate, results of statistical analysis should include analysis of relative/absolute risks and confidence analysis. Large datasets, including raw data, may be submitted as supporting files for publication as supplementary appendices. The author should refer to the Table/Figure number after the relevant description in the results section.
Discussion The discussion should clearly identify the main conclusions of the study. Authors should provide a clear explanation of the importance and relevance findings. Speculations on how the conclusions fit in or affect the existing assumptions or models should be explored. Suggestions for further key experiments for future work can be included. When appropriate, issues related to resource limitations faced by the researchers during the course of the study, how these were addressed, and suggestions for improvement may also be included.
Conflict of interest
ZVJ requires that all authors disclose any potential sources of conflict of interest. Any interest or relationship, financial or otherwise, that might be perceived as influencing an author's objectivity is considered a potential source of conflict of interest. If the authors have no conflict of interest to declare, the authors must state “None of the authors have any conflict of interest to declare..”
Acknowledgments Those who have made a substantial contribution to the study in terms of design, execution, analysis or manuscript drafting/revision but do not fit the criteria for authorship should be mentioned in this section. It is the responsibility of the authors to ensure that those being acknowledged have agreed to being named in such capacity. The source of funding for the study should be stated in this section.
References
ZVJ uses the numbered citation method. The references must be listed and numbered consecutively in the order in which they appear in the text. Citations should be indicated by their unique reference number in square brackets in the text. Where there are multiple citations within a single set of brackets these should be separated by commas without spaces. If there are three or more sequential citations, the numbers should be given as a range. Example: "……. [1,6-8,26]."
Reference format examples:
Papers Published in journals
Hanson, B.M.; Dressler, A.E.; Harper, A.L.; Scheibel, R.P.; Wardyn, S.E.; Roberts, L.K.; Kroeger, J.S. and Smith, T.C. (2011): Prevalence of Staphylococcus aureus and methicillin-resistant Staphylococcus aureus (MRSA) on retail meat in Iowa. J Infect Public Health, 4: 169-174.
Papers In Press
Kharitonov, S.A. and Barnes, P.J. Clinical aspects of exhaled nitric oxide. Adv Clin Path. In press.
Books
Whole Book
Lucas, A.O. and Gilles, H.M. (2003): Short textbook of public health medicine for the tropics, 4th edition. London: Arnold Press 389 p.
Book Chapter
Fernández, E. and Torres, A.C. (2006): Gender differentials in health. In Jamison, D.T.; Bremen, J.G.; Measham, A.R.; Alleyne, G.; Cleason, M.; Evans, D.B.; Jha, P.; Mills, A. and Musgrove, P. editors. Disease Control Priorities in Developing Countries. New York: Oxford University Press. 195-210.
Personal communication and unpublished data should be avoided.
For EndNote users;
The file below includes the EndNote style of the journal for direct export, please click here
Arabic Summary
An Arabic summary of the English abstract should be included at the end of the manuscript. The Arabic summary should match all the information and details highlighted in the English abstract. The count of Arabic summary words are not included in the total count of the manuscript.
Abbreviations, Symbols and Nomenclature
All specifications must be stated according to the S.I. system. Concentrations of chemical solutions are to be given in mol/l. All other concentrations should be given in % (volume or weight). Any abbreviations of chemical, biological, medical or other terms should only be employed when it is certain that they are internationally known. The full name must be stated in brackets when the abbreviation is first used.
All biological, medical, chemical or other terms should be used according to the most recent recommendations of the respective international nomenclature. Enzymes should be given in I.U. (International Units), according to Enzyme Nomenclature (Elsevier Publishing Co., 1965). In the case of commercially obtained substances or reagents, when they are first mentioned in the text, the name and address of the manufacturer or supplier should be given as a footnote. Products (preparations etc.) with a registered trademark should be marked with. Bacterial names should be in accordance with the latest edition of Bergey's Manual of Determinative Bacteriology (The Williams and Wilkins Co., Baltimore). Viruses are to be given the classification and names recommended by the International Committee on the Nomenclature of Viruses. Names of micro-organisms and zoological names should be in italics in the manuscript.
Tables
Submit each table with its title, in a separate word file. Use Arabic numerals to number tables. Details of experimental conditions should be included in the table footnotes. Manuscripts must contain no more than five figures and/or tables in total. Tables must be prepared using the same word processing package as the manuscript text. Tables must not include ruled vertical or horizontal lines with the exception of headers and footers.
Example for Tables
Table 1:
Primer sequences and expected product sizes of the multiplex PCR
Gene
Primer sequence (5'à3')
Expected product size (bp)
inlA1
inlA-Forward
ACGAGTAACGGGACAAATGC
800 bp
inlA-Reverse
CCCGACAGTGGTGCTAGATT
inlC2
inlC-Forward
AATTCCCACAGGACACAACC
517 bp
inlC-Reverse
CGGGAATGCAATTTTTCACTA
inlJ3
inlJ-Forward
TGTAACCCCGCTTACACAGTT
238 bp
inlJ-Reverse
AGCGGCTTGGCAGTCTAATA
1The inlA primers were intended for species-specific recognition, and the 2inlC and 3 inlJ primers were designed for virulence determination of L. monocytogenes.
Table 2:
Figures
Figure legends should follow the References in the manuscript file and the Figures should be in a separate electronic file (tif or jpg). They should be numbered consecutively using Arabic numerals (Figure1, Figure 2, Figure 3).
Potential Reviewers
It is mandatory during the online submission to provide the names, affiliations and email address of TWO potential reviewers. It is not guaranteed that the Editor In Chief will send the manuscript to these reviewers.
Fees
For publication in Zag. Vet J., 300 Egyptian Pounds (or equivalent in US dollars) should be paid on the day of manuscript submission for reviewing and proofreading charges.
Page charges for this journal are set at 25 Egyptian Pounds per typeset page (or equivalent in US dollars). After acceptance of the article, an email will be sent to the corresponding author with the required page charges. Nonpayment of page charges may result in a delay in publication.
Payment Methods
1. Direct payment to the editorial office of the journal at Faculty of Veterinary Medicine, Zagazig University, Sharkia Governorate, Egypt.
2. Postal Transaction to Mr. Hamza Ali Mohamed Ali (ID: 26201101301935), then email the receipt of the transaction to zvj@vet.zu.edu.eg.
Reprints
Hard copies (current or archived) issues can be delivered upon request with the appropriate cost according to the number of pages, copies and transportation.
Additional reprints for authors can also be delivered.
After acceptance of the manuscript
English language editing: Final English language editing will be done by experts after receipt of the article-processing charge.
Proof Corrections: The corresponding author will receive an e-mail containing PDF. A working e-mail address must, therefore, be provided for the corresponding author. The proof can be downloaded as a PDF (portable document format).
Proofs must be returned to the Editor within two days of receipt with corrections if any. If there is no correction then the corresponding author must have to reply accordingly. We ask that you only correct typesetting errors and grammatical errors if any. Please note that the author is responsible for all statements made in their work, including changes made.
Online publication and reprints: Author can download the PDF from the site. Reprints (hard copy) can be sent by post on request by the author, or, they can be collected from the Editorial office. Six hard copies of the manuscript are prepared and their charge are included within the publication fees. Online articles are complete and final. They have been fully reviewed, revised and edited for publication, and the authors' final corrections have been incorporated. We do assign DOI to each newly published article.
Contact Information
Editorial Secretary: DR. Heba Ahmed
Assistant Professor of Zoonoses, Faculty of Veterinary Medicine, Zagazig University.
Top